Online Inquiry
MAST1 Knockout Cell Line
SPL-02054
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | MAST1 |
| Gene Abbr. | MAST1 |
| Gene ID | 22983 |
| Full Name | microtubule associated serine/threonine kinase 1 |
| Alias | MCCCHCM, SAST |
| Species | Human |
| Genomic Locus | chr19:12840452 |
| Transcript | NM_014975 |
| WT Expression Level | 12.37 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is a member of the microtubule-associated serine/threonine kinase (MAST) family. The protein encoded by this gene has an N-terminal serine/threonine kinase domain followed by a postsynaptic density protein-95/discs large/zona occludens-1 (PDZ) domain. In mouse and rat, the orthologous protein associates with the cytoskeleton and can bind both beta-2-syntrophin and neuronal nitric oxide synthase (nNOS) through its PDZ domain. In mouse and rat, this protein also co-localizes with dystrophin- and utrophin-associated protein complexes (DAPC/UAPC) in the vascular endothelium of the central nervous system. [provided by RefSeq, May 2017]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of MAST1. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGCTTTTCCGATTACTGGTG |
| PCR Primer |
Forward: TTATCCAAACTGGTTCGCCTCCATT Reverse: TTTCTTCGAGAAACCCTCCCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.