Online Inquiry
MARK4 Knockout Cell Line
SPL-02051
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 29bp deletion |
| Target Information | |
|---|---|
| Target Name | MARK |
| Gene Abbr. | MARK4 |
| Gene ID | 57787 |
| Full Name | microtubule affinity regulating kinase 4 |
| Alias | MARK4L, MARK4S, MARKL1, MARKL1L, PAR-1D |
| Species | Human |
| Genomic Locus | chr19:45264848 |
| Transcript | NM_031417 |
| WT Expression Level | 27.00 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the microtubule affinity-regulating kinase family. These protein kinases phosphorylate microtubule-associated proteins and regulate the transition between stable and dynamic microtubules. The encoded protein is associated with the centrosome throughout mitosis and may be involved in cell cycle control. Expression of this gene is a potential marker for cancer, and the encoded protein may also play a role in Alzheimer's disease. Pseudogenes of this gene are located on both the short and long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 29bp deletion in a coding exon of MARK4. |
| Description | 29bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTTGACTACCTCGTGTCGCA |
| PCR Primer |
Forward: GTGATTGAGACTGAGAAGACGCTG Reverse: AGACCATGCCCAGCTCTCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.