MARK3 Knockout Cell Line - CD BioSciences

service-banner

MARK3 Knockout Cell Line

MARK3 Knockout Cell Line

SPL-02048

Size Price
1 Unit Online Inquiry
Description
17bp deletion
Target Information
Target Name MARK
Gene Abbr. MARK3
Gene ID 4140
Full Name microtubule affinity regulating kinase 3
Alias CTAK1, KP78, PAR1A, Par-1a, VIPB
Species Human
Genomic Locus chr14:103405178
Transcript NM_001128921
WT Expression Level 64.04 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is activated by phosphorylation and in turn is involved in the phosphorylation of tau proteins MAP2 and MAP4. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of MARK3.
Description 17bp deletion
Parental Cell Line C631
Guide RNA Sequence AGTCTGTAGTTTCCGATGTG
PCR Primer Forward: GCAAGTACTCTGTGTTCTCTCATTT
Reverse: TCTCTGCCTGTAAGGATATGTCTTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.