MARK3 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

MARK3 cDNA ORF Clone, Human, N-FLAG tag

MARK3 cDNA ORF Clone, Human, N-FLAG tag

SPD-10048

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human MAP/microtubule affinity-regulating kinase 3 with N terminal Flag tag.
Target Information
Species Human
Target Name MARK
Gene Abbr. MARK3
Gene ID 4140
Full Name microtubule affinity regulating kinase 3
Alias CTAK1, KP78, PAR1A, Par-1a, VIPB
Introduction Microtubule associated proteins regulate the stability of microtubules and control processes such as cell polarity/differentiation, neurite outgrowth, cell division and organelle trafficking. The MARK (MAP/microtubule affinity-regulating kinases) family (MARK1-4) of serine/threonine kinases was identified based on their ability to phosphorylate microtubule-associated proteins (MAPs) including tau, MAP2 and MAP4. MARK proteins phosphorylate MAPs within their microtubule binding domains, causing dissociation of MAPs from microtubules and increased microtubule dynamics. In the case of tau, phosphorylation has been hypothesized to contribute to the formation of neurofibrillary tangles observed in Alzheimer's disease. Overexpression of MARK leads to hyperphosphorylation of MAPs, morphological changes and cell death. The tumor suppressor kinase LKB1 phosphorylates MARK and the closely related AMP-kinases within their T-loops, leading to increased activity.MARK3 is an ubiquitously expressed member of the MARK/EMK/Par-1 family that was identified as Cdc25C-associated protein kinase (C-TAK1) based on its association and ability to phosphorylate Cdc25C. MARK3 substrates include Cdc25C phosphatase, MAPK scaffold kinase suppressor of Ras1 (KSR1) protein-tyrosine phosphatase H1 (PTPH1) plakophilin 2 (PKP2) and histone deacetylases (HDACs). MARK3 phosphorylates Cdc25C on serine 216 in response to DNA damage which allows for the preferential binding of 14-3-3 proteins that control entry into mitosis. MARK3 has also been shown to phosphorylate HDAC7 on one of its 14-3-3 binding sites that effects both the subcellular localization and repressive function of the HDAC.
Product Details
Description Full length Clone DNA of Human MAP/microtubule affinity-regulating kinase 3 with N terminal Flag tag.
NCBI Ref Seq BC024773
RefSeq ORF Size 2190 bp
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.