Online Inquiry
MARK3 cDNA ORF Clone, Human, C-Myc tag
SPD-10045
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human MAP/microtubule affinity-regulating kinase 3 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | MARK |
Gene Abbr. | MARK3 |
Gene ID | 4140 |
Full Name | microtubule affinity regulating kinase 3 |
Alias | CTAK1, KP78, PAR1A, Par-1a, VIPB |
Introduction | Microtubule associated proteins regulate the stability of microtubules and control processes such as cell polarity/differentiation, neurite outgrowth, cell division and organelle trafficking. The MARK (MAP/microtubule affinity-regulating kinases) family (MARK1-4) of serine/threonine kinases was identified based on their ability to phosphorylate microtubule-associated proteins (MAPs) including tau, MAP2 and MAP4. MARK proteins phosphorylate MAPs within their microtubule binding domains, causing dissociation of MAPs from microtubules and increased microtubule dynamics. In the case of tau, phosphorylation has been hypothesized to contribute to the formation of neurofibrillary tangles observed in Alzheimer's disease. Overexpression of MARK leads to hyperphosphorylation of MAPs, morphological changes and cell death. The tumor suppressor kinase LKB1 phosphorylates MARK and the closely related AMP-kinases within their T-loops, leading to increased activity.MARK3 is an ubiquitously expressed member of the MARK/EMK/Par-1 family that was identified as Cdc25C-associated protein kinase (C-TAK1) based on its association and ability to phosphorylate Cdc25C. MARK3 substrates include Cdc25C phosphatase, MAPK scaffold kinase suppressor of Ras1 (KSR1) protein-tyrosine phosphatase H1 (PTPH1) plakophilin 2 (PKP2) and histone deacetylases (HDACs). MARK3 phosphorylates Cdc25C on serine 216 in response to DNA damage which allows for the preferential binding of 14-3-3 proteins that control entry into mitosis. MARK3 has also been shown to phosphorylate HDAC7 on one of its 14-3-3 binding sites that effects both the subcellular localization and repressive function of the HDAC. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human MAP/microtubule affinity-regulating kinase 3 with C terminal Myc tag. |
NCBI Ref Seq | BC024773 |
RefSeq ORF Size | 2235 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Restriction Sites | KpnI + NotI (6kb + 2.24kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.