Mapt cDNA ORF Clone, Mouse, N-HA tag - CD BioSciences

service-banner

Mapt cDNA ORF Clone, Mouse, N-HA tag

Mapt cDNA ORF Clone, Mouse, N-HA tag

SPD-14438

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse microtubule-associated protein tau with N terminal HA tag.
Target Information
Species Mouse
Target Name Tau
Gene Abbr. Mapt
Gene ID 17762
Full Name microtubule-associated protein tau
Alias AI413597, AW045860, Mta, Mtapt, Ta
Introduction Tau is a neuronal microtubule associated protein found predominantly on axons. The function of Tau is to promote tubulin polymerisation and stabilise microtubules, but it also serves to link certain signalling pathways to the cytoskeleton. Tau, in its hyperphosphorylated form, is the major component of paired helical filaments (PHF) and neurofibrillary lesions in Alzheimer's disease (AD) brain. Hyperphosphorylation impairs the microtubule binding function of Tau, resulting in the destabilisation of microtubules in AD brains, ultimately leading to the degeneration of the affected neurons. Hyperphosphorylated tau is also found in a range of other central nervous system disorders. Numerous serine/threonine kinases, including GSK3 beta, PKA, Cdk5, and casein kinase II can phosphorylate Tau.
Product Details
Description Full length Clone DNA of Mouse microtubule-associated protein tau with N terminal HA tag.
NCBI Ref Seq NM_010838.4
RefSeq ORF Size 1119 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.