Online Inquiry
Mapt cDNA ORF Clone, Mouse, C-His tag
SPD-14432
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse microtubule-associated protein tau |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Tau |
| Gene Abbr. | Mapt |
| Gene ID | 17762 |
| Full Name | microtubule-associated protein tau |
| Alias | AI413597, AW045860, Mta, Mtapt, Ta |
| Introduction | Tau is a neuronal microtubule associated protein found predominantly on axons. The function of Tau is to promote tubulin polymerisation and stabilise microtubules, but it also serves to link certain signalling pathways to the cytoskeleton. Tau, in its hyperphosphorylated form, is the major component of paired helical filaments (PHF) and neurofibrillary lesions in Alzheimer's disease (AD) brain. Hyperphosphorylation impairs the microtubule binding function of Tau, resulting in the destabilisation of microtubules in AD brains, ultimately leading to the degeneration of the affected neurons. Hyperphosphorylated tau is also found in a range of other central nervous system disorders. Numerous serine/threonine kinases, including GSK3 beta, PKA, Cdk5, and casein kinase II can phosphorylate Tau. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse microtubule-associated protein tau |
| NCBI Ref Seq | NM_010838.4 |
| RefSeq ORF Size | 1119 bp |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.