MAPT cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

MAPT cDNA ORF Clone, Human, untagged

MAPT cDNA ORF Clone, Human, untagged

SPD-14452

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human microtubule-associated protein tau (MAPT), transcript variant 4.
Target Information
Species Human
Target Name Tau
Gene Abbr. MAPT
Gene ID 4137
Full Name microtubule associated protein tau
Alias DDPAC, FTDP-17, MAPTL, MSTD, MTBT1
Introduction Tau is a neuronal microtubule associated protein found predominantly on axons. The function of Tau is to promote tubulin polymerisation and stabilise microtubules, but it also serves to link certain signalling pathways to the cytoskeleton. Tau, in its hyperphosphorylated form, is the major component of paired helical filaments (PHF) and neurofibrillary lesions in Alzheimer's disease (AD) brain. Hyperphosphorylation impairs the microtubule binding function of Tau, resulting in the destabilisation of microtubules in AD brains, ultimately leading to the degeneration of the affected neurons. Hyperphosphorylated tau is also found in a range of other central nervous system disorders. Numerous serine/threonine kinases, including GSK3 beta, PKA, Cdk5, and casein kinase II can phosphorylate Tau.
Product Details
Description Full length Clone DNA of Human microtubule-associated protein tau (MAPT), transcript variant 4.
NCBI Ref Seq NM_016841.2
RefSeq ORF Size 1059 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.06kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.