MAPKAPK5 Knockout Cell Line - CD BioSciences

service-banner

MAPKAPK5 Knockout Cell Line

MAPKAPK5 Knockout Cell Line

SPL-02042

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name MAPKAPK-5
Gene Abbr. MAPKAPK5
Gene ID 8550
Full Name MAPK activated protein kinase 5
Alias MAPKAP-K5, MK-5, MK5, PRAK
Species Human
Genomic Locus chr12:111880502
Transcript NM_139078
WT Expression Level 42.53 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a tumor suppressor and member of the serine/threonine kinase family. In response to cellular stress and proinflammatory cytokines, this kinase is activated through its phosphorylation by MAP kinases including MAPK1/ERK, MAPK14/p38-alpha, and MAPK11/p38-beta. The encoded protein is found in the nucleus but translocates to the cytoplasm upon phosphorylation and activation. This kinase phosphorylates heat shock protein HSP27 at its physiologically relevant sites. Two alternately spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of MAPKAPK5.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence GTAAGTGTAGGGCGTCGGTG
PCR Primer Forward: TGGAAGTGTAGTGTTTATGTGGAGT
Reverse: GCTTCTTTGGGGCAGGAATATTAAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.