Online Inquiry
MAPKAPK5 cDNA ORF Clone, Human, untagged
SPD-10042
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human mitogen-activated protein kinase-activated protein kinase 5 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | MAPKAPK-5 |
| Gene Abbr. | MAPKAPK5 |
| Gene ID | 8550 |
| Full Name | MAPK activated protein kinase 5 |
| Alias | MAPKAP-K5, MK-5, MK5, PRAK |
| Introduction | MAPKAPK-5 belongs to the mitogen-activated protein kinase (MAPK) activated protein kinases (MK) subfamily that includes MAPKAPK-2/MK2 and MK3/3pK. The MK subfamily is part of a family of protein kinase subfamilies downstream of MAPK pathways and includes ribosomal S6 kinase (RSKs), mitogen and stress activated kinases (MSKs) and MAPK-interacting kinases (MNKs). All MKs are activated by MAPK pathways and mediate important processes (e.g. gene expression, cell cycle progression) and have been implicated in inflammation and cancer. MAPKAPK-5 shows binding to and activation by p38 MAPK and extracellular-regulated kinases (Erk). MAPKAPK-5 was shown to be activated by Erk3 and act as a chaperone to Erk3. While overexpressed MAPKAPK-5 shares similar substrates with MAPKAPK-2, such as HSP27 and glycogen synthase, recent work with MAPKAPK-5 knock-out mice indicates distinct substrates and functional properties. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human mitogen-activated protein kinase-activated protein kinase 5 |
| NCBI Ref Seq | NM_003668.3 |
| RefSeq ORF Size | 1416 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.42kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.