Online Inquiry
Mapk8ip1 cDNA ORF Clone, Mouse, untagged
SPD-09453
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse mitogen-activated protein kinase 8 interacting protein 1. |
Target Information | |
---|---|
Species | Mouse |
Target Name | JIP1 |
Gene Abbr. | Mapk8ip1 |
Gene ID | 19099 |
Full Name | mitogen-activated protein kinase 8 interacting protein 1 |
Alias | IB, IB1, JIP, JIP-1, Ji |
Introduction | JNK-interacting proteins (JIPs) comprise a family of four scaffolding proteins that tether and assemble components of the JNK signaling cascade. JIP1, also known as islet-brain 1 (IB1) and mitogen-activated protein kinase 8-interacting protein 1 (MAPK8IP1), contains an N-terminal JNK-binding domain, and C-terminal MLK- and MKK7-binding domains. JIP1 is ubiquitously expressed, with highest levels in brain and in pancreatic beta -cells. Mice lacking JIP1 are resistant to diet-induced obesity and show reduced diet-induced insulin resistance. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse mitogen-activated protein kinase 8 interacting protein 1. |
NCBI Ref Seq | NM_001202445.1 |
RefSeq ORF Size | 2097 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.