Mapk8ip1 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Mapk8ip1 cDNA ORF Clone, Mouse, N-FLAG tag

Mapk8ip1 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-09448

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase 8 interacting protein 1 with N terminal Flag tag.
Target Information
Species Mouse
Target Name JIP1
Gene Abbr. Mapk8ip1
Gene ID 19099
Full Name mitogen-activated protein kinase 8 interacting protein 1
Alias IB, IB1, JIP, JIP-1, Ji
Introduction JNK-interacting proteins (JIPs) comprise a family of four scaffolding proteins that tether and assemble components of the JNK signaling cascade. JIP1, also known as islet-brain 1 (IB1) and mitogen-activated protein kinase 8-interacting protein 1 (MAPK8IP1), contains an N-terminal JNK-binding domain, and C-terminal MLK- and MKK7-binding domains. JIP1 is ubiquitously expressed, with highest levels in brain and in pancreatic beta -cells. Mice lacking JIP1 are resistant to diet-induced obesity and show reduced diet-induced insulin resistance.
Product Details
Description Full length Clone DNA of Mouse mitogen-activated protein kinase 8 interacting protein 1 with N terminal Flag tag.
NCBI Ref Seq NM_001202445.1
RefSeq ORF Size 2097 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.