Online Inquiry
MAPK8 Knockout Cell Line
SPL-02032
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | JNK1 |
| Gene Abbr. | MAPK8 |
| Gene ID | 5599 |
| Full Name | mitogen-activated protein kinase 8 |
| Alias | JNK, JNK-46, JNK1, JNK1A2, JNK21B1/2 |
| Species | Human |
| Genomic Locus | chr10:48404915 |
| Transcript | NM_002750 |
| WT Expression Level | 12.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of MAPK8. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAATCAGACTCATGCCAAGC |
| PCR Primer |
Forward: TAGAAGACACATGTTGAGCGTCATA Reverse: AATACAGAACAATTTAAAGCCCCTAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.