Online Inquiry
MAPK8 cDNA ORF Clone, Human, untagged
SPD-09476
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human mitogen-activated protein kinase 8, transcript variant JNK1-b2. |
Target Information | |
---|---|
Species | Human |
Target Name | JNK1 |
Gene Abbr. | MAPK8 |
Gene ID | 5599 |
Full Name | mitogen-activated protein kinase 8 |
Alias | JNK, JNK-46, JNK1, JNK1A2, JNK21B1/2 |
Introduction | The stress-activated protein kinase/Jun-amino-terminal kinase SAPK/JNK is potently and preferentially activated by a variety of environmental stresses including UV and gamma radiation, ceramides, inflammatory cytokines, and in some instances, growth factors and GPCR agonists. As with the other MAPKs, the core signaling unit is composed of a MAPKKK, typically MEKK1-MEKK4, or by one of the mixed lineage kinases (MLKs), which phosphorylate and activate MKK4/7. Upon activation, MKKs phosphorylate and activate the SAPK/JNK kinase. Stress signals are delivered to this cascade by small GTPases of the Rho family (Rac, Rho, cdc42). Both Rac1 and cdc42 mediate the stimulation of MEKKs and MLKs. Alternatively, MKK4/7 can be activated in a GTPase-independent mechanism via stimulation of a germinal center kinase (GCK) family member. There are three SAPK/JNK genes each of which undergoes alternative splicing, resulting in numerous isoforms. SAPK/JNK, when active as a dimer, can translocate to the nucleus and regulate transcription through its effects on c-Jun, ATF-2, and other transcription factors. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human mitogen-activated protein kinase 8, transcript variant JNK1-b2. |
NCBI Ref Seq | NM_001278547.1 |
RefSeq ORF Size | 1284 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.