MAPK8 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

MAPK8 cDNA ORF Clone, Human, N-FLAG tag

MAPK8 cDNA ORF Clone, Human, N-FLAG tag

SPD-09472

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human mitogen-activated protein kinase 8, transcript variant JNK1-b2 with N terminal Flag tag.
Target Information
Species Human
Target Name JNK1
Gene Abbr. MAPK8
Gene ID 5599
Full Name mitogen-activated protein kinase 8
Alias JNK, JNK-46, JNK1, JNK1A2, JNK21B1/2
Introduction The stress-activated protein kinase/Jun-amino-terminal kinase SAPK/JNK is potently and preferentially activated by a variety of environmental stresses including UV and gamma radiation, ceramides, inflammatory cytokines, and in some instances, growth factors and GPCR agonists. As with the other MAPKs, the core signaling unit is composed of a MAPKKK, typically MEKK1-MEKK4, or by one of the mixed lineage kinases (MLKs), which phosphorylate and activate MKK4/7. Upon activation, MKKs phosphorylate and activate the SAPK/JNK kinase. Stress signals are delivered to this cascade by small GTPases of the Rho family (Rac, Rho, cdc42). Both Rac1 and cdc42 mediate the stimulation of MEKKs and MLKs. Alternatively, MKK4/7 can be activated in a GTPase-independent mechanism via stimulation of a germinal center kinase (GCK) family member. There are three SAPK/JNK genes each of which undergoes alternative splicing, resulting in numerous isoforms. SAPK/JNK, when active as a dimer, can translocate to the nucleus and regulate transcription through its effects on c-Jun, ATF-2, and other transcription factors.
Product Details
Description Full length Clone DNA of Human mitogen-activated protein kinase 8, transcript variant JNK1-b2 with N terminal Flag tag.
NCBI Ref Seq NM_001278547.1
RefSeq ORF Size 1323 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + NotI (6kb + 1.32kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.