MAPK7 Knockout Cell Line - CD BioSciences

service-banner

MAPK7 Knockout Cell Line

MAPK7 Knockout Cell Line

SPL-02031

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name Erk5
Gene Abbr. MAPK7
Gene ID 5598
Full Name mitogen-activated protein kinase 7
Alias BMK1, ERK4, ERK5, PRKM7
Species Human
Genomic Locus chr17:19380719
Transcript NM_139034
WT Expression Level 16.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is specifically activated by mitogen-activated protein kinase kinase 5 (MAP2K5/MEK5). It is involved in the downstream signaling processes of various receptor molecules including receptor type kinases, and G protein-coupled receptors. In response to extracelluar signals, this kinase translocates to cell nucleus, where it regulates gene expression by phosphorylating, and activating different transcription factors. Four alternatively spliced transcript variants of this gene encoding two distinct isoforms have been reported. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of MAPK7.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence GAAGTACATGCACTCGGCTC
PCR Primer Forward: TAAGGCTGTTACCTGTCTGGAATC
Reverse: CAGTCATGAAGTACTGATGTTCAGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.