MAPK7 cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

MAPK7 cDNA ORF Clone, Human, N-His tag

MAPK7 cDNA ORF Clone, Human, N-His tag

SPD-05363

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human mitogen-activated protein kinase 7 (MAPK7), transcript variant 3 with N terminal His tag.
Target Information
Species Human
Target Name Erk5
Gene Abbr. MAPK7
Gene ID 5598
Full Name mitogen-activated protein kinase 7
Alias BMK1, ERK4, ERK5, PRKM7
Introduction Erk5 (Mitogen-activated protein kinase 7, Big mitogen-activated protein kinase 1) is a member of the MAPK superfamily implicated in the regulation numerous cellular processes including proliferation, differentiation, and survival. Like other MAPK family members, Erk5 contains a canonical activation loop TEY motif (Thr218/Tyr220) that is specifically phosphorylated by MAP2K5 (MEK5) in a growth-factor-dependent, Ras-independent mechanism. For example, EGF stimulation promotes Erk5 phosphorylation that induces its translocation to the nucleus where it phosphorylates MEF2C and other transcriptional targets. Erk5 is also activated in response to granulocyte colony-stimulating factor (G-CSF) in hematopoietic progenitor cells where it promotes survival and proliferation. In neuronal cells, Erk5 is required for NGF-induced neurite outgrowth, neuronal homeostasis, and survival. Erk5 is thought to play a role in blood vessel integrity via maintenance of endothelial cell migration and barrier function. Although broadly expressed, research studies have shown that mice lacking erk5 display numerous cardiac defects, suggesting Erk5 plays a critical role in vascular development and homeostasis.
Product Details
Description Full length Clone DNA of Human mitogen-activated protein kinase 7 (MAPK7), transcript variant 3 with N terminal His tag.
NCBI Ref Seq NM_002749.2
RefSeq ORF Size 2451 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.