Online Inquiry
MAPK7 cDNA ORF Clone, Human, C-HA tag
SPD-05360
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human mitogen-activated protein kinase 7 (MAPK7), transcript variant 3 with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Erk5 |
| Gene Abbr. | MAPK7 |
| Gene ID | 5598 |
| Full Name | mitogen-activated protein kinase 7 |
| Alias | BMK1, ERK4, ERK5, PRKM7 |
| Introduction | Erk5 (Mitogen-activated protein kinase 7, Big mitogen-activated protein kinase 1) is a member of the MAPK superfamily implicated in the regulation numerous cellular processes including proliferation, differentiation, and survival. Like other MAPK family members, Erk5 contains a canonical activation loop TEY motif (Thr218/Tyr220) that is specifically phosphorylated by MAP2K5 (MEK5) in a growth-factor-dependent, Ras-independent mechanism. For example, EGF stimulation promotes Erk5 phosphorylation that induces its translocation to the nucleus where it phosphorylates MEF2C and other transcriptional targets. Erk5 is also activated in response to granulocyte colony-stimulating factor (G-CSF) in hematopoietic progenitor cells where it promotes survival and proliferation. In neuronal cells, Erk5 is required for NGF-induced neurite outgrowth, neuronal homeostasis, and survival. Erk5 is thought to play a role in blood vessel integrity via maintenance of endothelial cell migration and barrier function. Although broadly expressed, research studies have shown that mice lacking erk5 display numerous cardiac defects, suggesting Erk5 plays a critical role in vascular development and homeostasis. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human mitogen-activated protein kinase 7 (MAPK7), transcript variant 3 with C terminal HA tag. |
| NCBI Ref Seq | NM_002749.2 |
| RefSeq ORF Size | 2451 bp |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.