MAPK6 Knockout Cell Line - CD BioSciences

service-banner

MAPK6 Knockout Cell Line

MAPK6 Knockout Cell Line

SPL-02029

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name MAPK6
Gene Abbr. MAPK6
Gene ID 5597
Full Name mitogen-activated protein kinase 6
Alias ERK3, HsT17250, PRKM6, p97MAPK
Species Human
Genomic Locus chr15:52061337
Transcript NM_002748
WT Expression Level 28.03 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of the Ser/Thr protein kinase family, and is most closely related to mitogen-activated protein kinases (MAP kinases). MAP kinases also known as extracellular signal-regulated kinases (ERKs), are activated through protein phosphorylation cascades and act as integration points for multiple biochemical signals. This kinase is localized in the nucleus, and has been reported to be activated in fibroblasts upon treatment with serum or phorbol esters. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of MAPK6.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence TCTGCTGTTAACCGATCCAT
PCR Primer Forward: TTCCTGTTGTGTAGTATGTAGTGCT
Reverse: GTGACTGTGAGTTTCATCCATAAGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.