MAPK6 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

MAPK6 cDNA ORF Clone, Human, untagged

MAPK6 cDNA ORF Clone, Human, untagged

SPD-10011

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human mitogen-activated protein kinase 6.
Target Information
Species Human
Target Name MAPK6
Gene Abbr. MAPK6
Gene ID 5597
Full Name mitogen-activated protein kinase 6
Alias ERK3, HsT17250, PRKM6, p97MAPK
Product Details
Description Full length Clone DNA of Human mitogen-activated protein kinase 6.
NCBI Ref Seq NM_002748.2
RefSeq ORF Size 2166 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.