MAPK3 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

MAPK3 cDNA ORF Clone, Human, N-Myc tag

MAPK3 cDNA ORF Clone, Human, N-Myc tag

SPD-05333

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human mitogen-activated protein kinase 3 with N terminal Myc tag.
Target Information
Species Human
Target Name Erk1
Gene Abbr. MAPK3
Gene ID 5595
Full Name mitogen-activated protein kinase 3
Alias ERK-1, ERK1, ERT2, HS44KDAP, HUMKER1A
Introduction Mitogen-activated protein kinases (MAPKs) are a widely conserved family of serine/threonine protein kinases involved in many cellular programs, such as cell proliferation, differentiation, motility, and death. The p44/42 MAPK (Erk1/2) signaling pathway can be activated in response to a diverse range of extracellular stimuli including mitogens, growth factors, and cytokines , and research investigators consider it an important target in the diagnosis and treatment of cancer. Upon stimulation, a sequential three-part protein kinase cascade is initiated, consisting of a MAP kinase kinase kinase (MAPKKK or MAP3K), a MAP kinase kinase (MAPKK or MAP2K), and a MAP kinase (MAPK). Multiple p44/42 MAP3Ks have been identified, including members of the Raf family, as well as Mos and Tpl2/COT. MEK1 and MEK2 are the primary MAPKKs in this pathway. MEK1 and MEK2 activate p44 and p42 through phosphorylation of activation loop residues Thr202/Tyr204 and Thr185/Tyr187, respectively. Several downstream targets of p44/42 have been identified, including p90RSK and the transcription factor Elk-1. p44/42 are negatively regulated by a family of dual-specificity (Thr/Tyr) MAPK phosphatases, known as DUSPs or MKPs, along with MEK inhibitors, such as U0126 and PD98059.
Product Details
Description Full length Clone DNA of Human mitogen-activated protein kinase 3 with N terminal Myc tag.
NCBI Ref Seq NM_002746.2
RefSeq ORF Size 1185 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI (two restriction sites) + XbaI (6kb + 0.68kb + 0.52kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.