Online Inquiry
MAPK3 cDNA ORF Clone, Human, N-FLAG tag
SPD-05331
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human mitogen-activated protein kinase 3 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Erk1 |
Gene Abbr. | MAPK3 |
Gene ID | 5595 |
Full Name | mitogen-activated protein kinase 3 |
Alias | ERK-1, ERK1, ERT2, HS44KDAP, HUMKER1A |
Introduction | Mitogen-activated protein kinases (MAPKs) are a widely conserved family of serine/threonine protein kinases involved in many cellular programs, such as cell proliferation, differentiation, motility, and death. The p44/42 MAPK (Erk1/2) signaling pathway can be activated in response to a diverse range of extracellular stimuli including mitogens, growth factors, and cytokines , and research investigators consider it an important target in the diagnosis and treatment of cancer. Upon stimulation, a sequential three-part protein kinase cascade is initiated, consisting of a MAP kinase kinase kinase (MAPKKK or MAP3K), a MAP kinase kinase (MAPKK or MAP2K), and a MAP kinase (MAPK). Multiple p44/42 MAP3Ks have been identified, including members of the Raf family, as well as Mos and Tpl2/COT. MEK1 and MEK2 are the primary MAPKKs in this pathway. MEK1 and MEK2 activate p44 and p42 through phosphorylation of activation loop residues Thr202/Tyr204 and Thr185/Tyr187, respectively. Several downstream targets of p44/42 have been identified, including p90RSK and the transcription factor Elk-1. p44/42 are negatively regulated by a family of dual-specificity (Thr/Tyr) MAPK phosphatases, known as DUSPs or MKPs, along with MEK inhibitors, such as U0126 and PD98059. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human mitogen-activated protein kinase 3 with N terminal Flag tag. |
NCBI Ref Seq | NM_002746.2 |
RefSeq ORF Size | 1140 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 45G/T and48G/T not causing the amino acid variation. |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI (two restriction sites) + XbaI (0.67kb + 0.52kb + 6kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.