MAPK13 Knockout Cell Line - CD BioSciences

service-banner

MAPK13 Knockout Cell Line

MAPK13 Knockout Cell Line

SPL-02022

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name p38 MAPK
Gene Abbr. MAPK13
Gene ID 5603
Full Name mitogen-activated protein kinase 13
Alias MAPK 13, MAPK-13, PRKM13, SAPK4, p38delta
Species Human
Genomic Locus chr6:36131342
Transcript NM_002754
WT Expression Level 0.60 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the mitogen-activated protein (MAP) kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The encoded protein is a p38 MAP kinase and is activated by proinflammatory cytokines and cellular stress. Substrates of the encoded protein include the transcription factor ATF2 and the microtubule dynamics regulator stathmin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of MAPK13.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence TCTTCGCCAAGCGCGCCTAC
PCR Primer Forward: ATATTCTAGGTGGTGGGCCTAGT
Reverse: TCCTTTCAATAGTGAGGCGAGAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.