Mapk13 cDNA ORF Clone, Mouse, N-Myc tag - CD BioSciences

service-banner

Mapk13 cDNA ORF Clone, Mouse, N-Myc tag

Mapk13 cDNA ORF Clone, Mouse, N-Myc tag

SPD-10948

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase 13 with N terminal Myc tag.
Target Information
Species Mouse
Target Name p38 MAPK
Gene Abbr. Mapk13
Gene ID 26415
Full Name mitogen-activated protein kinase 13
Alias SA, SAPK4, Ser, Serk4
Introduction p38 MAP kinase (MAPK), also called RK or CSBP, is the mammalian orthologue of the yeast HOG kinase that participates in a signaling cascade controlling cellular responses to cytokines and stress. Four isoforms of p38 MAPK, p38α, β, γ (also known as Erk6 or SAPK3), and δ (also known as SAPK4) have been identified. Similar to the SAPK/JNK pathway, p38 MAPK is activated by a variety of cellular stresses including osmotic shock, inflammatory cytokines, lipopolysaccharide (LPS), UV light, and growth factors. MKK3, MKK6, and SEK activate p38 MAPK by phosphorylation at Thr180 and Tyr182. Activated p38 MAPK has been shown to phosphorylate and activate MAPKAP kinase 2 and to phosphorylate the transcription factors ATF-2, Max, and MEF2. SB203580 (4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)-imidazole) is a selective inhibitor of p38 MAPK. This compound inhibits the activation of MAPKAPK-2 by p38 MAPK and subsequent phosphorylation of HSP27. SB203580 inhibits p38 MAPK catalytic activity by binding to the ATP-binding pocket, but does not inhibit phosphorylation of p38 MAPK by upstream kinases.
Product Details
Description Full length Clone DNA of Mouse mitogen-activated protein kinase 13 with N terminal Myc tag.
NCBI Ref Seq NM_011950.2
RefSeq ORF Size 1101 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.