Online Inquiry
MAPK12 cDNA ORF Clone, Human, untagged
SPD-10940
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human mitogen-activated protein kinase 12 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | p38 MAPK |
| Gene Abbr. | MAPK12 |
| Gene ID | 6300 |
| Full Name | mitogen-activated protein kinase 12 |
| Alias | ERK-6, ERK3, ERK6, MAPK 12, P38GAMMA |
| Introduction | Erk3, also known as MAPK6 or p97 MAPK, is almost 50% identical to Erk1/2 at the kinase domain located in its amino-terminal region. However, Erk3 is distinguished from other MAP kinases in that it lacks the conserved TXY motif in its activation loop, possessing instead an SEG motif. Phosphorylation at Ser189 in the SEG motif has been reported. With limited information about its upstream kinases and downstream substrates, the significance of this phosphorylation remains to be elucidated. Erk3 is an inherently unstable protein, rapidly degraded through amino-terminal ubiquitination and proteasome degradation. A site-specific cleavage, depending on a short stretch of acidic residues of Erk3, might regulate its translocation from the Golgi/ERGIC to the nucleus during the cell cycle. Accumulating evidence suggests that Erk3 is involved in cell differentiation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human mitogen-activated protein kinase 12 |
| NCBI Ref Seq | NM_001303252.1 |
| RefSeq ORF Size | 1074 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 183T/C,603T/C not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | HindIII + NotI (6.1kb + 1.07kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.