Online Inquiry
Mapk11 cDNA ORF Clone, Mouse, C-His tag
SPD-10930
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse mitogen-activated protein kinase 11 with C terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | p38 MAPK |
Gene Abbr. | Mapk11 |
Gene ID | 19094 |
Full Name | mitogen-activated protein kinase 11 |
Alias | P38, P38b, Prkm, Prkm11, Sa |
Introduction | p38 MAP kinase (MAPK), also called RK or CSBP, is the mammalian orthologue of the yeast HOG kinase that participates in a signaling cascade controlling cellular responses to cytokines and stress. Four isoforms of p38 MAPK, p38α, β, γ (also known as Erk6 or SAPK3), and δ (also known as SAPK4) have been identified. Similar to the SAPK/JNK pathway, p38 MAPK is activated by a variety of cellular stresses including osmotic shock, inflammatory cytokines, lipopolysaccharide (LPS), UV light, and growth factors. MKK3, MKK6, and SEK activate p38 MAPK by phosphorylation at Thr180 and Tyr182. Activated p38 MAPK has been shown to phosphorylate and activate MAPKAP kinase 2 and to phosphorylate the transcription factors ATF-2, Max, and MEF2. SB203580 (4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)-imidazole) is a selective inhibitor of p38 MAPK. This compound inhibits the activation of MAPKAPK-2 by p38 MAPK and subsequent phosphorylation of HSP27. SB203580 inhibits p38 MAPK catalytic activity by binding to the ATP-binding pocket, but does not inhibit phosphorylation of p38 MAPK by upstream kinases. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse mitogen-activated protein kinase 11 with C terminal His tag. |
NCBI Ref Seq | NM_011161.5 |
RefSeq ORF Size | 1095 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.