Online Inquiry
MAP4K5 Knockout Cell Line
SPL-02016
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 19bp deletion |
| Target Information | |
|---|---|
| Target Name | MAP4K5 |
| Gene Abbr. | MAP4K5 |
| Gene ID | 11183 |
| Full Name | mitogen-activated protein kinase kinase kinase kinase 5 |
| Alias | GCKR, KHS, KHS1, MAPKKKK5 |
| Species | Human |
| Genomic Locus | chr14:50531973 |
| Transcript | NM_006575 |
| WT Expression Level | 59.28 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of MAP4K5. |
| Description | 19bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TACGAACTCGTCCAGAGGGT |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGGTTATAAATCCCTGAAAGGAACCGC Reverse: GGCCCTAAGTGAAGATGGAGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.