Online Inquiry
MAP3K8 Knockout Cell Line
SPL-02007
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 35bp deletion |
| Target Information | |
|---|---|
| Target Name | Tpl2 |
| Gene Abbr. | MAP3K8 |
| Gene ID | 1326 |
| Full Name | mitogen-activated protein kinase kinase kinase 8 |
| Alias | AURA2, COT, EST, ESTF, MEKK8 |
| Species | Human |
| Genomic Locus | chr10:30447811 |
| Transcript | NM_005204 |
| WT Expression Level | 11.20 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 35bp deletion in a coding exon of MAP3K8. |
| Description | 35bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGAGAACATCGGAATCTATT |
| PCR Primer |
Forward: TGTACAGTTGGTAGGATTAAGCACA Reverse: TACCAGTTTACACGCCATTCTTTTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.