Online Inquiry
Map3k8 cDNA ORF Clone, Mouse, N-Myc tag
SPD-15101
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse mitogen-activated protein kinase kinase kinase 8 with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Tpl2 |
| Gene Abbr. | Map3k8 |
| Gene ID | 26410 |
| Full Name | mitogen-activated protein kinase kinase kinase 8 |
| Alias | Co, Cot, Cot/T, Cot/Tpl2, Est |
| Introduction | Tpl2 (tumor progression locus 2), also known as COT (cancer osaka thyroid), is a serine/threonine kinase expressed primarily in hematopoietic tissues, lung and liver. Over-expression of Tpl2 potentiates MAP kinase pathways through MEK1 and SEK1, as well as through MKK6 and MEK5. Tpl2 is also engaged in NF-κB activation through NF-κB inducing kinase (NIK), or by inducing phosphorylation and degradation of the NF-κB precusor, p105 NF-κB1. Ser400 of Tpl2 is phosphorylated in an Akt-dependent manner. This phosphorylation is required for Tpl2-induced NF-κB-dependent transcription. Tpl2 also activates caspase-3 by promoting the assembly of a protein complex of Apaf1 (apoptotic protease-activating factor 1), caspase-9, Tpl2, adaptor protein Tvl1 and procaspase-3. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse mitogen-activated protein kinase kinase kinase 8 with N terminal Myc tag. |
| NCBI Ref Seq | NM_007746.2 |
| RefSeq ORF Size | 1449 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Restriction Sites | KpnI + XbaI (6kb + 1.45kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.