Map3k8 cDNA ORF Clone, Mouse, N-HA tag - CD BioSciences

service-banner

Map3k8 cDNA ORF Clone, Mouse, N-HA tag

Map3k8 cDNA ORF Clone, Mouse, N-HA tag

SPD-15102

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase kinase kinase 8 with N terminal HA tag.
Target Information
Species Mouse
Target Name Tpl2
Gene Abbr. Map3k8
Gene ID 26410
Full Name mitogen-activated protein kinase kinase kinase 8
Alias Co, Cot, Cot/T, Cot/Tpl2, Est
Introduction Tpl2 (tumor progression locus 2), also known as COT (cancer osaka thyroid), is a serine/threonine kinase expressed primarily in hematopoietic tissues, lung and liver. Over-expression of Tpl2 potentiates MAP kinase pathways through MEK1 and SEK1, as well as through MKK6 and MEK5. Tpl2 is also engaged in NF-κB activation through NF-κB inducing kinase (NIK), or by inducing phosphorylation and degradation of the NF-κB precusor, p105 NF-κB1. Ser400 of Tpl2 is phosphorylated in an Akt-dependent manner. This phosphorylation is required for Tpl2-induced NF-κB-dependent transcription. Tpl2 also activates caspase-3 by promoting the assembly of a protein complex of Apaf1 (apoptotic protease-activating factor 1), caspase-9, Tpl2, adaptor protein Tvl1 and procaspase-3.
Product Details
Description Full length Clone DNA of Mouse mitogen-activated protein kinase kinase kinase 8 with N terminal HA tag.
NCBI Ref Seq NM_007746.2
RefSeq ORF Size 1404 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.