Online Inquiry
MAP3K7 Knockout Cell Line
SPL-02003
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | TAK1 |
| Gene Abbr. | MAP3K7 |
| Gene ID | 6885 |
| Full Name | mitogen-activated protein kinase kinase kinase 7 |
| Alias | CSCF, FMD2, MEKK7, TAK1, TGF1a |
| Species | Human |
| Genomic Locus | chr6:90568588 |
| Transcript | NM_145333 |
| WT Expression Level | 18.62 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase mediates the signaling transduction induced by TGF beta and morphogenetic protein (BMP), and controls a variety of cell functions including transcription regulation and apoptosis. In response to IL-1, this protein forms a kinase complex including TRAF6, MAP3K7P1/TAB1 and MAP3K7P2/TAB2; this complex is required for the activation of nuclear factor kappa B. This kinase can also activate MAPK8/JNK, MAP2K4/MKK4, and thus plays a role in the cell response to environmental stresses. Four alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of MAP3K7. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AATATTAGGATGGTTCACAC |
| PCR Primer |
Forward: TAAACTACACACACACATCTGCCAT Reverse: ACTATGATTGCAATGCCTGTTACAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.