Online Inquiry
MAP3K7 cDNA ORF Clone, Human, C-FLAG tag
SPD-14399
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 7 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | TAK1 |
| Gene Abbr. | MAP3K7 |
| Gene ID | 6885 |
| Full Name | mitogen-activated protein kinase kinase kinase 7 |
| Alias | CSCF, FMD2, MEKK7, TAK1, TGF1a |
| Introduction | TAK1 is a mitogen-activated protein kinase kinase kinase that can be activated by TGF-β, bone morphogenetic protein and other cytokines including IL-1. In vivo activation of TAK1 requires association with TAK1 binding protein 1 (TAB1), which triggers phosphorylation of TAK1. Another adaptor protein, TAB2, links TAK1 with TRAF6 and mediates TAK1 activation upon IL-1 stimulation. Once activated, TAK1 phosphorylates MAPK kinases MKK4 and MKK3/6, which activate p38 MAPK and JNK, respectively. In addition, TAK1 activates the NF-κB pathway by interacting with TRAF6 and phosphorylating the NF-κB inducing kinase (NIK).TAK1 activation requires multiple phosphorylations in its activation loop. Mutations at Thr187 and Thr184, residues located in the activation loop of TAK1, impairs phosphorylation of both TAK1 and TAB1 and reduces the kinase activity of TAK1, suggesting that autophosphorylation of these residues is necessary for TAK1 activation. TAK1 is also phosphorylated at Ser412 in a PKA-dependent manner. A mutation of Ser412 to alanine acts as a dominant negative for PKA-enhanced degradation of IκBα, phosphorylation of p38 MAPK and prostaglandin E2-enhances osteoclastic differentiation in RAW264.7 cells. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 7 |
| NCBI Ref Seq | BC017715 |
| RefSeq ORF Size | 1779 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV mammalian cell promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 1.78kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.