MAP3K5 Knockout Cell Line - CD BioSciences

service-banner

MAP3K5 Knockout Cell Line

MAP3K5 Knockout Cell Line

SPL-02001

Size Price
1 Unit Online Inquiry
Description
17bp deletion
Target Information
Target Name ASK1
Gene Abbr. MAP3K5
Gene ID 4217
Full Name mitogen-activated protein kinase kinase kinase 5
Alias ASK1, MAPKKK5, MEKK5
Species Human
Genomic Locus chr6:136791872
Transcript NM_005923
WT Expression Level 8.03 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of MAP3K5.
Description 17bp deletion
Parental Cell Line C631
Guide RNA Sequence CATATGCCACCGTGGTCCGT
PCR Primer Forward: GGTTTCTCCAAAGTCGAGTTTCCC
Reverse: CAGCTTCTGGAACGTGGAGAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.