Online Inquiry
MAP3K5 cDNA ORF Clone, Human, untagged
SPD-01040
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 5 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | ASK1 |
| Gene Abbr. | MAP3K5 |
| Gene ID | 4217 |
| Full Name | mitogen-activated protein kinase kinase kinase 5 |
| Alias | ASK1, MAPKKK5, MEKK5 |
| Introduction | Apoptosis signal-regulating kinase 1 (ASK1), a MAP kinase kinase kinase, plays essential roles in stress-induced apoptosis. ASK1 is activated in response to a variety of stress-related stimuli through distinct mechanisms and activates MKK4 and MKK3, which in turn activate JNK and p38. Overexpression of ASK1 activates JNK and p38 and induces apoptosis in several cell types through signals involving the mitochondrial cell death pathway. Embryonic fibroblasts or primary neurons derived from ASK1-/- mice are resistant to stress-induced JNK and p38 activation as well as cell death. Phosphorylation at Ser967 is essential for ASK1 association with 14-3-3 proteins and suppression of cell death. Oxidative stress induces dephosphorylation of Ser967 and phosphorylation of Thr845 in the activation loop of ASK1, both of which are correlated with ASK1 activity and ASK1-dependent apoptosis. Akt phosphorylates ASK1 at Ser83, which attenuates ASK1 activity and promotes cell survival. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 5 |
| NCBI Ref Seq | NM_005923.3 |
| RefSeq ORF Size | 4125 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 159C/T,594A/C not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | KpnI (Four restriction sites) + XbaI (6.1kb + 1.53kb + 1.00kb + 0.38kb + 1.22kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.