MAP3K3 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

MAP3K3 cDNA ORF Clone, Human, N-Myc tag

MAP3K3 cDNA ORF Clone, Human, N-Myc tag

SPD-10303

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 3 with N terminal Myc tag.
Target Information
Species Human
Target Name MEKK3
Gene Abbr. MAP3K3
Gene ID 4215
Full Name mitogen-activated protein kinase kinase kinase 3
Alias MAPKKK3, MEKK3
Introduction MAP kinase kinase kinase (MEKK3 or MAP3K3) is a serine/threonine protein kinase that activates SAPK and ERK via phosphorylation and activation of their respective MAP kinase kinases, SEK and MEK1/2. MEKK3 also stimulates MEK5 via activation of ERK5/BMK1, which is at least partly regulated by a direct interaction between MEK5 and MEKK3 via p67phox-Bem1p (PB1) protein-protein interaction domains found in both proteins. MEKK3 modulates NF-κB activation in response to a variety of agonists including TNFα, LPS, IL-1 and LPA. Despite reports showing that phosphorylation of MEKK3 at Ser526 within the activation loop is necessary for kinase activation, at least one study suggests that dual phosphorylation at Thr516 and Ser520 is required for LPA-stimulated IKKβ/NF-κB activation. Phosphorylation at Thr294 appears to negatively regulate MEKK3 by promoting 14-3-3β binding and inhibition of the kinase activity. Phosphorylation of MEKK3 at Thr294 is diminished upon treatment of cells with LPS or TNFα, further suggesting an inhibitory role for this site.
Product Details
Description Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 3 with N terminal Myc tag.
NCBI Ref Seq NM_002401.3
RefSeq ORF Size 1926 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 1.93kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.