Online Inquiry
MAP3K3 cDNA ORF Clone, Human, N-HA tag
SPD-10304
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 3 with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | MEKK3 |
Gene Abbr. | MAP3K3 |
Gene ID | 4215 |
Full Name | mitogen-activated protein kinase kinase kinase 3 |
Alias | MAPKKK3, MEKK3 |
Introduction | MAP kinase kinase kinase (MEKK3 or MAP3K3) is a serine/threonine protein kinase that activates SAPK and ERK via phosphorylation and activation of their respective MAP kinase kinases, SEK and MEK1/2. MEKK3 also stimulates MEK5 via activation of ERK5/BMK1, which is at least partly regulated by a direct interaction between MEK5 and MEKK3 via p67phox-Bem1p (PB1) protein-protein interaction domains found in both proteins. MEKK3 modulates NF-κB activation in response to a variety of agonists including TNFα, LPS, IL-1 and LPA. Despite reports showing that phosphorylation of MEKK3 at Ser526 within the activation loop is necessary for kinase activation, at least one study suggests that dual phosphorylation at Thr516 and Ser520 is required for LPA-stimulated IKKβ/NF-κB activation. Phosphorylation at Thr294 appears to negatively regulate MEKK3 by promoting 14-3-3β binding and inhibition of the kinase activity. Phosphorylation of MEKK3 at Thr294 is diminished upon treatment of cells with LPS or TNFα, further suggesting an inhibitory role for this site. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 3 with N terminal HA tag. |
NCBI Ref Seq | NM_002401.3 |
RefSeq ORF Size | 1881 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.