Online Inquiry
MAP3K20 Knockout Cell Line
SPL-01993
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | MAP3K20 |
| Gene Abbr. | MAP3K20 |
| Gene ID | 51776 |
| Full Name | mitogen-activated protein kinase kinase kinase 20 |
| Alias | AZK, CNM6, MLK7, MLT, MLTK |
| Species | Human |
| Genomic Locus | chr2:173091114 |
| Transcript | NM_016653 |
| Introduction | This gene is a member of the MAPKKK family of signal transduction molecules and encodes a protein with an N-terminal kinase catalytic domain, followed by a leucine zipper motif and a sterile-alpha motif (SAM). This magnesium-binding protein forms homodimers and is located in the cytoplasm. The protein mediates gamma radiation signaling leading to cell cycle arrest and activity of this protein plays a role in cell cycle checkpoint regulation in cells. The protein also has pro-apoptotic activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of ZAK. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGAGTGTTTATCGAGCCAAA |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGCGTTTATTGTGTGTTCAGTTTGCAG Reverse: AAATGGTATCGTGACTGTTTCTGTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.