MAP3K2 Knockout Cell Line - CD BioSciences

service-banner

MAP3K2 Knockout Cell Line

MAP3K2 Knockout Cell Line

SPL-01991

Size Price
1 Unit Online Inquiry
Description
5bp deletion
Target Information
Target Name MEKK2
Gene Abbr. MAP3K2
Gene ID 10746
Full Name mitogen-activated protein kinase kinase kinase 2
Alias MEKK2, MEKK2B
Species Human
Genomic Locus chr2:127338985
Transcript NM_006609
WT Expression Level 9.52 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase preferentially activates other kinases involved in the MAP kinase signaling pathway. This kinase has been shown to directly phosphorylate and activate Ikappa B kinases, and thus plays a role in NF-kappa B signaling pathway. This kinase has also been found to bind and activate protein kinase C-related kinase 2, which suggests its involvement in a regulated signaling process. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of MAP3K2.
Description 5bp deletion
Parental Cell Line C631
Guide RNA Sequence CTGGTCGACTGGCCTTATGA
PCR Primer Forward: TGTAAAACGACGGCCAGTTCGAAAGTGTAAAAGCTGAACACA
Reverse: TTCCAAATACAGTAGGCCAGTATCC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.