Online Inquiry
MAP3K2 Knockout Cell Line
SPL-01990
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | MEKK2 |
| Gene Abbr. | MAP3K2 |
| Gene ID | 10746 |
| Full Name | mitogen-activated protein kinase kinase kinase 2 |
| Alias | MEKK2, MEKK2B |
| Species | Human |
| Genomic Locus | chr2:127338985 |
| Transcript | NM_006609 |
| WT Expression Level | 9.52 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase preferentially activates other kinases involved in the MAP kinase signaling pathway. This kinase has been shown to directly phosphorylate and activate Ikappa B kinases, and thus plays a role in NF-kappa B signaling pathway. This kinase has also been found to bind and activate protein kinase C-related kinase 2, which suggests its involvement in a regulated signaling process. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of MAP3K2. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGGTCGACTGGCCTTATGA |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGTTCGAAAGTGTAAAAGCTGAACACA Reverse: TTCCAAATACAGTAGGCCAGTATCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.