MAP3K2 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

MAP3K2 cDNA ORF Clone, Human, untagged

MAP3K2 cDNA ORF Clone, Human, untagged

SPD-10285

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 2.
Target Information
Species Human
Target Name MEKK2
Gene Abbr. MAP3K2
Gene ID 10746
Full Name mitogen-activated protein kinase kinase kinase 2
Alias MEKK2, MEKK2B
Introduction Mitogen-activated protein kinase kinase kinase 2 (MEKK2/MAP3K2) belongs to the MAP3K family of Ser/Thr kinases. Research studies have demonstrated that MEKK2 plays a pivotal role in transducing mitogenic signals emanating from EGFR and FGF2R to JNK and ERK5 signaling cascades. Post-translationally MEKK2 is regulated through multiple mechanisms including: dimerization, ubiquitination, phosphorylation and methylation. Research studies implicate dysregulation of MEKK2 signaling in breast carcinoma colorectal carcinoma and pancreatic ductal adenocarcinoma.
Product Details
Description Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 2.
NCBI Ref Seq NM_006609.3
RefSeq ORF Size 1860 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutation 861T/C not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.86kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.