Online Inquiry
MAP3K2 cDNA ORF Clone, Human, C-His tag
SPD-10277
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 2 with C terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | MEKK2 |
Gene Abbr. | MAP3K2 |
Gene ID | 10746 |
Full Name | mitogen-activated protein kinase kinase kinase 2 |
Alias | MEKK2, MEKK2B |
Introduction | Mitogen-activated protein kinase kinase kinase 2 (MEKK2/MAP3K2) belongs to the MAP3K family of Ser/Thr kinases. Research studies have demonstrated that MEKK2 plays a pivotal role in transducing mitogenic signals emanating from EGFR and FGF2R to JNK and ERK5 signaling cascades. Post-translationally MEKK2 is regulated through multiple mechanisms including: dimerization, ubiquitination, phosphorylation and methylation. Research studies implicate dysregulation of MEKK2 signaling in breast carcinoma colorectal carcinoma and pancreatic ductal adenocarcinoma. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 2 with C terminal His tag. |
NCBI Ref Seq | NM_006609.3 |
RefSeq ORF Size | 1860 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.