Online Inquiry
MAP3K14 cDNA ORF Clone, Human, C-FLAG tag
SPD-10773
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 14 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | NIK |
Gene Abbr. | MAP3K14 |
Gene ID | 9020 |
Full Name | mitogen-activated protein kinase kinase kinase 14 |
Alias | FTDCR1B, HS, HSNIK, NIK |
Introduction | Transcription factors of the nuclear factor κB (NF-κB)/Rel family play a pivotal role in inflammatory and immune responses. There are five family members in mammals: RelA, c-Rel, RelB, NF-κB1 (p105/p50), and NF-κB2 (p100/p52). Both p105 and p100 are proteolytically processed by the proteasome to produce p50 and p52, respectively. Rel proteins bind p50 and p52 to form dimeric complexes that bind DNA and regulate transcription. In unstimulated cells, NF-κB is sequestered in the cytoplasm by IκB inhibitory proteins. NF-κB-activating agents can induce the phosphorylation of IκB proteins, targeting them for rapid degradation through the ubiquitin-proteasome pathway and releasing NF-κB to enter the nucleus where it regulates gene expression. NIK and IKKα (IKK1) regulate the phosphorylation and processing of NF-κB2 (p100) to produce p52, which translocates to the nucleus.Activation of NF-kappaB can be controlled by NF-kB-inducing kinase (NIK), a member of the MAP3K family that was originally identified as a TRAF2-interacting protein and thereby coupled to receptor activation. NIK forms a complex with and phosphorylates IKK1 and IKK2, subsequently leading to the phosphorylation of IkappaB and translocation of NF-kappaB to the nucleus. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 14 with C terminal Flag tag. |
NCBI Ref Seq | BC035576 |
RefSeq ORF Size | 2883 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 2.88kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.