Online Inquiry
MAP3K12 Knockout Cell Line
SPL-01983
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
14bp deletion |
Target Information | |
---|---|
Target Name | MAP3K12 |
Gene Abbr. | MAP3K12 |
Gene ID | 7786 |
Full Name | mitogen-activated protein kinase kinase kinase 12 |
Alias | DLK, MEKK12, MUK, ZPK, ZPKP1 |
Species | Human |
Genomic Locus | chr12:53487067 |
Transcript | NM_001193511 |
WT Expression Level | 3.74 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the serine/threonine protein kinase family. This kinase contains a leucine-zipper domain and is predominately expressed in neuronal cells. The phosphorylation state of this kinase in synaptic terminals was shown to be regulated by membrane depolarization via calcineurin. This kinase forms heterodimers with leucine zipper containing transcription factors, such as cAMP responsive element binding protein (CREB) and MYC, and thus may play a regulatory role in PKA or retinoic acid induced neuronal differentiation. Alternatively spliced transcript variants encoding different proteins have been described.[provided by RefSeq, Jul 2010]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of MAP3K12. |
Description | 14bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | ATCCAGAGTTCGAGCTGACG |
PCR Primer |
Forward: GTAGGCTTTGCCAATCATGGTC Reverse: CAGTGTGTACTTCGAGATGTGGTA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.