Online Inquiry
MAP3K11 Knockout Cell Line
SPL-01982
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 17bp deletion |
| Target Information | |
|---|---|
| Target Name | MLK3 |
| Gene Abbr. | MAP3K11 |
| Gene ID | 4296 |
| Full Name | mitogen-activated protein kinase kinase kinase 11 |
| Alias | MEKK11, MLK-3, MLK3, PTK1, SPRK |
| Species | Human |
| Genomic Locus | chr11:65613591 |
| Transcript | NM_002419 |
| WT Expression Level | 21.16 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. This kinase preferentially activates MAPK8/JNK kinase, and functions as a positive regulator of JNK signaling pathway. This kinase can directly phosphorylate, and activates IkappaB kinase alpha and beta, and is found to be involved in the transcription activity of NF-kappaB mediated by Rho family GTPases and CDC42. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of MAP3K11. |
| Description | 17bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CACTGGGCTCGTAGTCGAAC |
| PCR Primer |
Forward: GACACATAGTTGGACGGGAAGAT Reverse: AAGAGCCCTCTAGGGTCATGGAAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.