MAP3K11 cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

MAP3K11 cDNA ORF Clone, Human, C-His tag

MAP3K11 cDNA ORF Clone, Human, C-His tag

SPD-10412

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 11 with C terminal His tag.
Target Information
Species Human
Target Name MLK3
Gene Abbr. MAP3K11
Gene ID 4296
Full Name mitogen-activated protein kinase kinase kinase 11
Alias MEKK11, MLK-3, MLK3, PTK1, SPRK
Introduction Mixed lineage kinase 3 (MLK3) is a serine/threonine kinase that has an amino-terminal SH3 domain followed by the kinase domain and two leucine zippers, a cdc42/Rac1 binding (CRIB) domain and several other domains/motifs at the carboxy-terminal region. CRIB triggers the dimerization of MLK3 via its tandem leucine zippers, followed by the intramolecular phosphorylation and subsequent activation of MLK3. Autophosphorylation of Thr277 and Ser281 is essential for MLK3 kinase activity. Ser281 is also phosphorylated by HPK in an in vitro kinase assay. MLK3 functions as a MAPKKK of the SAPK/JNK stress pathway by directly phosphorylating SEK1/MKK4 and MKK7, although it is controversial whether MLK3 is involved in p38 stress pathway activation. MLK3 also functions as an IκB kinase and mediates the activation of the transcriptional factor NF-κB stimulated by CD3/CD28, suggesting a role for MLK3 in immune and inflammatory responses.
Product Details
Description Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 11 with C terminal His tag.
NCBI Ref Seq NM_002419.3
RefSeq ORF Size 2544 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.