Online Inquiry
MAP3K11 cDNA ORF Clone, Human, C-HA tag
SPD-10414
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 11 with C terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | MLK3 |
Gene Abbr. | MAP3K11 |
Gene ID | 4296 |
Full Name | mitogen-activated protein kinase kinase kinase 11 |
Alias | MEKK11, MLK-3, MLK3, PTK1, SPRK |
Introduction | Mixed lineage kinase 3 (MLK3) is a serine/threonine kinase that has an amino-terminal SH3 domain followed by the kinase domain and two leucine zippers, a cdc42/Rac1 binding (CRIB) domain and several other domains/motifs at the carboxy-terminal region. CRIB triggers the dimerization of MLK3 via its tandem leucine zippers, followed by the intramolecular phosphorylation and subsequent activation of MLK3. Autophosphorylation of Thr277 and Ser281 is essential for MLK3 kinase activity. Ser281 is also phosphorylated by HPK in an in vitro kinase assay. MLK3 functions as a MAPKKK of the SAPK/JNK stress pathway by directly phosphorylating SEK1/MKK4 and MKK7, although it is controversial whether MLK3 is involved in p38 stress pathway activation. MLK3 also functions as an IκB kinase and mediates the activation of the transcriptional factor NF-κB stimulated by CD3/CD28, suggesting a role for MLK3 in immune and inflammatory responses. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 11 with C terminal HA tag. |
NCBI Ref Seq | NM_002419.3 |
RefSeq ORF Size | 2544 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.