Online Inquiry
MAP3K10 Knockout Cell Line
SPL-01980
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 20bp deletion |
| Target Information | |
|---|---|
| Target Name | MLK2 |
| Gene Abbr. | MAP3K10 |
| Gene ID | 4294 |
| Full Name | mitogen-activated protein kinase kinase kinase 10 |
| Alias | MEKK10, MLK2, MST |
| Species | Human |
| Genomic Locus | chr19:40192328 |
| Transcript | NM_002446 |
| WT Expression Level | 8.41 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase has been shown to activate MAPK8/JNK and MKK4/SEK1, and this kinase itself can be phoshorylated, and thus activated by JNK kinases. This kinase functions preferentially on the JNK signaling pathway, and is reported to be involved in nerve growth factor (NGF) induced neuronal apoptosis. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of MAP3K10. |
| Description | 20bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTAGAGGAGATCATCGGTG |
| PCR Primer |
Forward: CGTCCAGGTGCTTTCCCAAG Reverse: CTTGACTGCCACCTCCTCG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.