MAP3K1 Knockout Cell Line - CD BioSciences

service-banner

MAP3K1 Knockout Cell Line

MAP3K1 Knockout Cell Line

SPL-01976

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name MEKK1
Gene Abbr. MAP3K1
Gene ID 4214
Full Name mitogen-activated protein kinase kinase kinase 1
Alias MAPKKK1, MEKK, MEKK 1, MEKK1, SRXY6
Species Human
Genomic Locus chr5:56871978
Transcript NM_005921
WT Expression Level 3.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of MAP3K1.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence CAGTGTGTGAAGACGGCTGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.