Online Inquiry
MAP3K1 Knockout Cell Line
SPL-01976
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
10bp deletion |
Target Information | |
---|---|
Target Name | MEKK1 |
Gene Abbr. | MAP3K1 |
Gene ID | 4214 |
Full Name | mitogen-activated protein kinase kinase kinase 1 |
Alias | MAPKKK1, MEKK, MEKK 1, MEKK1, SRXY6 |
Species | Human |
Genomic Locus | chr5:56871978 |
Transcript | NM_005921 |
WT Expression Level | 3.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of MAP3K1. |
Description | 10bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CAGTGTGTGAAGACGGCTGC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.