Online Inquiry
MAP2K7 Knockout Cell Line
SPL-01974
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
116bp insertion |
Target Information | |
---|---|
Target Name | MKK7 |
Gene Abbr. | MAP2K7 |
Gene ID | 5609 |
Full Name | mitogen-activated protein kinase kinase 7 |
Alias | JNKK2, MAPKK7, MEK, MEK 7, MKK7 |
Species | Human |
Genomic Locus | chr19:7909849 |
Transcript | NM_145185 |
WT Expression Level | 12.37 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically activates MAPK8/JNK1 and MAPK9/JNK2, and this kinase itself is phosphorylated and activated by MAP kinase kinase kinases including MAP3K1/MEKK1, MAP3K2/MEKK2,MAP3K3/MEKK5, and MAP4K2/GCK. This kinase is involved in the signal transduction mediating the cell responses to proinflammatory cytokines, and environmental stresses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 116bp insertion in a coding exon of MAP2K7. |
Description | 116bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | TTGACGGGAGCCCCAGCATG |
PCR Primer |
Forward: TGTAAAACGACGGCCAGCTAGCCTCCTCCATCTCTTTCCAG Reverse: CAAGTTCTCCAGGTCGTTGATTTC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.