Online Inquiry
MAP2K6 cDNA ORF Clone, Human, N-Myc tag
SPD-10377
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human mitogen-activated protein kinase kinase 6 (MAP2K6) with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | MKK6 |
Gene Abbr. | MAP2K6 |
Gene ID | 5608 |
Full Name | mitogen-activated protein kinase kinase 6 |
Alias | MAPKK6, MEK6, MKK6, PRKMK6, SAPKK-3 |
Introduction | MKK3 and MKK6 are two closely related dual-specificity protein kinases that activate p38 MAP kinase. MKK3 and MKK6 both phosphorylate and activate p38 MAP kinase at its activation site, Thr-Gly-Tyr, but do not phosphorylate or activate Erk1/2 or SAPK/JNK. Phosphorylation of p38 MAP kinase dramatically stimulates its ability to phosphorylate protein substrates such as ATF-2 and Elk-1. MKK3 and MKK6 are both activated by different forms of cellular stress and inflammatory cytokines. Activation of MKK3 and MKK6 occurs through phosphorylation at Ser189 and Thr222 on MKK3 and Ser207 and Thr211 on MKK6. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human mitogen-activated protein kinase kinase 6 (MAP2K6) with N terminal Myc tag. |
NCBI Ref Seq | NM_002758.3 |
RefSeq ORF Size | 1050 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Restriction Sites | KpnI + XbaI (6kb + 1.05kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.